ID: 1006156494_1006156507

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1006156494 1006156507
Species Human (GRCh38) Human (GRCh38)
Location 6:32015691-32015713 6:32015744-32015766
Sequence CCCCTCCGAGCCCTCTCAGGATG AAAGAAAGTGCCACACAGAAGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 7, 4: 156} {0: 2, 1: 0, 2: 2, 3: 49, 4: 531}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!