ID: 1006631999_1006632013

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1006631999 1006632013
Species Human (GRCh38) Human (GRCh38)
Location 6:35436547-35436569 6:35436581-35436603
Sequence CCCAGCCATCATGGCTGGGCCCT ACCAGCAGGCCTGGGGCCATGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 22, 4: 273}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!