ID: 1006632009_1006632019

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1006632009 1006632019
Species Human (GRCh38) Human (GRCh38)
Location 6:35436575-35436597 6:35436590-35436612
Sequence CCTCCCACCAGCAGGCCTGGGGC CCTGGGGCCATGGGATGGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 56, 4: 484} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!