ID: 1007179971_1007179984

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1007179971 1007179984
Species Human (GRCh38) Human (GRCh38)
Location 6:39922923-39922945 6:39922969-39922991
Sequence CCTTCCTCCACCAGCACCCATCT GCTCTGAAGCAGCTCCTCTGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 78, 4: 652} {0: 1, 1: 0, 2: 7, 3: 26, 4: 255}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!