ID: 1007250440_1007250449

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1007250440 1007250449
Species Human (GRCh38) Human (GRCh38)
Location 6:40491436-40491458 6:40491462-40491484
Sequence CCCGGCTCTGGCCCCACTCCATT CTGTGTGACTGTGGGTAGGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 325} {0: 3, 1: 6, 2: 4, 3: 61, 4: 571}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!