ID: 1007396837_1007396846

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1007396837 1007396846
Species Human (GRCh38) Human (GRCh38)
Location 6:41582847-41582869 6:41582872-41582894
Sequence CCTCCACATTCTCTCCCTAACCC CCCAAGACCTGCCCTGCGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 50, 4: 518} {0: 1, 1: 0, 2: 0, 3: 26, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!