ID: 1007553386_1007553398

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1007553386 1007553398
Species Human (GRCh38) Human (GRCh38)
Location 6:42746718-42746740 6:42746734-42746756
Sequence CCCTCCCCCCTATCCACTGCAGT CTGCAGTTCGGCGCGGCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 639} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!