ID: 1007631410_1007631420

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1007631410 1007631420
Species Human (GRCh38) Human (GRCh38)
Location 6:43275363-43275385 6:43275398-43275420
Sequence CCCGTCGCCCCGCCTTCGCGCCC TTTTCCCTGCTGCTGGCTGGCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 47, 4: 374}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!