ID: 1007631422_1007631442

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1007631422 1007631442
Species Human (GRCh38) Human (GRCh38)
Location 6:43275403-43275425 6:43275440-43275462
Sequence CCTGCTGCTGGCTGGCGGCCTTT GGGGCGGGGGCGGGCTGGAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 30, 3: 327, 4: 2584}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!