ID: 1007702264_1007702275

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1007702264 1007702275
Species Human (GRCh38) Human (GRCh38)
Location 6:43772040-43772062 6:43772067-43772089
Sequence CCCAGAGTGGCGAGCGGCACCCC CCCGCCAGCCCTCCGCGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 79} {0: 1, 1: 0, 2: 0, 3: 9, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!