ID: 1007702266_1007702283

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1007702266 1007702283
Species Human (GRCh38) Human (GRCh38)
Location 6:43772059-43772081 6:43772094-43772116
Sequence CCCCTCCCCCCGCCAGCCCTCCG CTCTCGAGGTAGCCCCAGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 115, 4: 1441} {0: 1, 1: 0, 2: 1, 3: 7, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!