ID: 1007845346_1007845350

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1007845346 1007845350
Species Human (GRCh38) Human (GRCh38)
Location 6:44750270-44750292 6:44750307-44750329
Sequence CCCACTCAAAACCGCTCAACTAC ACCTGCTCCTGAATGAATACTGG
Strand - +
Off-target summary {0: 13, 1: 53, 2: 62, 3: 56, 4: 96} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!