ID: 1008062492_1008062497

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1008062492 1008062497
Species Human (GRCh38) Human (GRCh38)
Location 6:47013355-47013377 6:47013374-47013396
Sequence CCTTCCCCAGTTTACAGATGAGG GAGGAAACTGAGATCCACAAAGG
Strand - +
Off-target summary {0: 1, 1: 22, 2: 132, 3: 446, 4: 1122} {0: 1, 1: 1, 2: 57, 3: 421, 4: 2157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!