ID: 1008198651_1008198656

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1008198651 1008198656
Species Human (GRCh38) Human (GRCh38)
Location 6:48558508-48558530 6:48558554-48558576
Sequence CCAGGCTCAAGGCCAGCAGGCTT TCAGCTCAAGTTCAAAAGCTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!