ID: 1008480531_1008480538

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1008480531 1008480538
Species Human (GRCh38) Human (GRCh38)
Location 6:51981369-51981391 6:51981388-51981410
Sequence CCCTCCACGGTCTCCCTCTGATG GATGCCGAGCCAAGGCTGGACGG
Strand - +
Off-target summary {0: 87, 1: 19, 2: 6, 3: 18, 4: 219} {0: 21, 1: 57, 2: 62, 3: 49, 4: 155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!