|
Left Crispr |
Right Crispr |
Crispr ID |
1008480531 |
1008480538 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
6:51981369-51981391
|
6:51981388-51981410
|
Sequence |
CCCTCCACGGTCTCCCTCTGATG |
GATGCCGAGCCAAGGCTGGACGG |
Strand |
- |
+ |
Off-target summary |
{0: 87, 1: 19, 2: 6, 3: 18, 4: 219} |
{0: 21, 1: 57, 2: 62, 3: 49, 4: 155} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|