ID: 1008582767_1008582777

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1008582767 1008582777
Species Human (GRCh38) Human (GRCh38)
Location 6:52921471-52921493 6:52921518-52921540
Sequence CCCTGCTGGATCCAGAGGTATGG CGGCAAACAGCAGTGGTGGATGG
Strand - +
Off-target summary {0: 1, 1: 12, 2: 60, 3: 123, 4: 259} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!