ID: 1008932440_1008932466

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1008932440 1008932466
Species Human (GRCh38) Human (GRCh38)
Location 6:56954866-56954888 6:56954908-56954930
Sequence CCCCCGCCCCCGTCCGTGCGCAG CGGGGACGCGGCGAGTGGGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 25, 4: 348}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!