ID: 1008932441_1008932453

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1008932441 1008932453
Species Human (GRCh38) Human (GRCh38)
Location 6:56954867-56954889 6:56954889-56954911
Sequence CCCCGCCCCCGTCCGTGCGCAGC CCCCCGGGCGCAGCCCCGCCGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!