ID: 1008956599_1008956608

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1008956599 1008956608
Species Human (GRCh38) Human (GRCh38)
Location 6:57222342-57222364 6:57222355-57222377
Sequence CCCGCGGCCCTGCCCCGCCCCTG CCCGCCCCTGTTCTGGCGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 14, 3: 171, 4: 1081} {0: 1, 1: 0, 2: 1, 3: 10, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!