ID: 1008956600_1008956616

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1008956600 1008956616
Species Human (GRCh38) Human (GRCh38)
Location 6:57222343-57222365 6:57222379-57222401
Sequence CCGCGGCCCTGCCCCGCCCCTGT TGGCGGCGGCTCAGCTTTCCAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 17, 3: 173, 4: 1330} {0: 1, 1: 0, 2: 1, 3: 8, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!