ID: 1008956602_1008956617

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1008956602 1008956617
Species Human (GRCh38) Human (GRCh38)
Location 6:57222349-57222371 6:57222390-57222412
Sequence CCCTGCCCCGCCCCTGTTCTGGC CAGCTTTCCAGGCGCCTCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 77, 4: 627} {0: 1, 1: 0, 2: 0, 3: 20, 4: 190}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!