ID: 1008956607_1008956621

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1008956607 1008956621
Species Human (GRCh38) Human (GRCh38)
Location 6:57222355-57222377 6:57222399-57222421
Sequence CCCGCCCCTGTTCTGGCGGGTGG AGGCGCCTCCAAGGGAGCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 175} {0: 1, 1: 0, 2: 1, 3: 12, 4: 192}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!