ID: 1008956609_1008956620

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1008956609 1008956620
Species Human (GRCh38) Human (GRCh38)
Location 6:57222356-57222378 6:57222398-57222420
Sequence CCGCCCCTGTTCTGGCGGGTGGC CAGGCGCCTCCAAGGGAGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 134} {0: 1, 1: 0, 2: 0, 3: 26, 4: 264}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!