|
Left Crispr |
Right Crispr |
| Crispr ID |
1008986537 |
1008986538 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
6:57550651-57550673
|
6:57550702-57550724
|
| Sequence |
CCTTATGGATTATGCTGATATAT |
ATTTTATTCAACATTTTAAAAGG |
| Strand |
- |
+ |
| Off-target summary |
No data |
{0: 3, 1: 1, 2: 9, 3: 170, 4: 1514} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|