ID: 1009261789_1009261791

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1009261789 1009261791
Species Human (GRCh38) Human (GRCh38)
Location 6:61500015-61500037 6:61500031-61500053
Sequence CCAGTTTTTATCCTGAGATATTC GATATTCACTTATTCACCATTGG
Strand - +
Off-target summary No data {0: 4, 1: 144, 2: 735, 3: 12628, 4: 26675}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!