ID: 1009366439_1009366449

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1009366439 1009366449
Species Human (GRCh38) Human (GRCh38)
Location 6:62861056-62861078 6:62861087-62861109
Sequence CCATATGGCGGGGGGTGTCCACA CACATGGATTGTAAGAGCCGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 5, 4: 85}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!