ID: 1009504768_1009504778

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1009504768 1009504778
Species Human (GRCh38) Human (GRCh38)
Location 6:64463093-64463115 6:64463142-64463164
Sequence CCCGCCACCACGCCCGGCTATTT GGGGTTTCACCGTGTTAGCCAGG
Strand - +
Off-target summary {0: 321, 1: 16490, 2: 60070, 3: 84991, 4: 68699} {0: 28592, 1: 58630, 2: 110316, 3: 159901, 4: 157923}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!