|
Left Crispr |
Right Crispr |
Crispr ID |
1009504770 |
1009504778 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
6:64463097-64463119
|
6:64463142-64463164
|
Sequence |
CCACCACGCCCGGCTATTTATTT |
GGGGTTTCACCGTGTTAGCCAGG |
Strand |
- |
+ |
Off-target summary |
No data |
{0: 28592, 1: 58630, 2: 110316, 3: 159901, 4: 157923} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|