ID: 1009716778_1009716783

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1009716778 1009716783
Species Human (GRCh38) Human (GRCh38)
Location 6:67408041-67408063 6:67408063-67408085
Sequence CCTGAGATAATTTCTAACAGCCT TGGAACTCCTTGGGAAAAACAGG
Strand - +
Off-target summary No data {0: 3, 1: 14, 2: 23, 3: 32, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!