ID: 1009847496_1009847509

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1009847496 1009847509
Species Human (GRCh38) Human (GRCh38)
Location 6:69151798-69151820 6:69151845-69151867
Sequence CCATCCAAATCTCATCTTTAATT CATGGGAGGGACCCAGTGGGAGG
Strand - +
Off-target summary No data {0: 530, 1: 1103, 2: 2381, 3: 3775, 4: 4654}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!