ID: 1009851923_1009851928

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1009851923 1009851928
Species Human (GRCh38) Human (GRCh38)
Location 6:69208938-69208960 6:69208986-69209008
Sequence CCACCAAAGCGCAGTAACAGGCC AGTTATCTGCAGAAGATGGCAGG
Strand - +
Off-target summary {0: 1, 1: 150, 2: 163, 3: 87, 4: 122} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!