ID: 1009978786_1009978796

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1009978786 1009978796
Species Human (GRCh38) Human (GRCh38)
Location 6:70701664-70701686 6:70701712-70701734
Sequence CCCACAATCACTGCGTTCTCCCT TCATACAGCTGCTGTCCAGGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 18, 4: 140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!