ID: 1010064980_1010064983

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1010064980 1010064983
Species Human (GRCh38) Human (GRCh38)
Location 6:71672034-71672056 6:71672057-71672079
Sequence CCTAGAGGAGAGGCATGGTATAT AACCCTTAGCTTTTGCTGGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 34, 4: 385}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!