ID: 1010866601_1010866611

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1010866601 1010866611
Species Human (GRCh38) Human (GRCh38)
Location 6:80983312-80983334 6:80983363-80983385
Sequence CCTAGAAAGTTCTAAATAACCCA ACTTTATATGTAATTAAAAGTGG
Strand - +
Off-target summary {0: 8, 1: 23, 2: 32, 3: 63, 4: 317} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!