ID: 1011069098_1011069105

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1011069098 1011069105
Species Human (GRCh38) Human (GRCh38)
Location 6:83361637-83361659 6:83361682-83361704
Sequence CCTGCCATCTTCTGCAGATAAAT CCTGGCCTGTTACTGGGCTTTGG
Strand - +
Off-target summary {0: 3, 1: 198, 2: 186, 3: 127, 4: 305} {0: 2, 1: 174, 2: 175, 3: 115, 4: 274}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!