ID: 1011326348_1011326352

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1011326348 1011326352
Species Human (GRCh38) Human (GRCh38)
Location 6:86152764-86152786 6:86152787-86152809
Sequence CCAGCTGCTTGTGTGTCTGCCTG CTAGGTTCTCAGGTTTCTATAGG
Strand - +
Off-target summary {0: 9, 1: 52, 2: 79, 3: 180, 4: 539} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!