ID: 1011370847_1011370852

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1011370847 1011370852
Species Human (GRCh38) Human (GRCh38)
Location 6:86634772-86634794 6:86634803-86634825
Sequence CCACGTAGCTCTGTGTGTCAGAC CTAGTGGAATGGGTTCACAAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!