ID: 1011934194_1011934199

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1011934194 1011934199
Species Human (GRCh38) Human (GRCh38)
Location 6:92754391-92754413 6:92754420-92754442
Sequence CCCATGGAGAAGGCTGTAACAGC CAGCTCAGCTTGGGGATGTCAGG
Strand - +
Off-target summary No data {0: 3, 1: 4, 2: 13, 3: 27, 4: 241}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!