ID: 1012326605_1012326615

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1012326605 1012326615
Species Human (GRCh38) Human (GRCh38)
Location 6:97927475-97927497 6:97927517-97927539
Sequence CCAAAAGCCCCACCTCTTAATAC TTTCATCATATGAATTTTGGGGG
Strand - +
Off-target summary No data {0: 2, 1: 295, 2: 1301, 3: 2725, 4: 4430}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!