ID: 1012616366_1012616377

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1012616366 1012616377
Species Human (GRCh38) Human (GRCh38)
Location 6:101283794-101283816 6:101283839-101283861
Sequence CCCCCACCAGTGTTCTCTAGCTG AGACTGAGCTCCCAGAGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 13, 3: 56, 4: 300} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!