ID: 1012799814_1012799823

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1012799814 1012799823
Species Human (GRCh38) Human (GRCh38)
Location 6:103811381-103811403 6:103811417-103811439
Sequence CCAGGCCCCCTTGCAAGTAGATA AATTTCTCAAAAATGAATGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 136} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!