ID: 1012920793_1012920797

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1012920793 1012920797
Species Human (GRCh38) Human (GRCh38)
Location 6:105219534-105219556 6:105219573-105219595
Sequence CCCAGTAACAGGCCAAGAGCTGT AGTTATCTGCAGAAGATGGCAGG
Strand - +
Off-target summary {0: 174, 1: 194, 2: 145, 3: 123, 4: 215} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!