ID: 1013015766_1013015771

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1013015766 1013015771
Species Human (GRCh38) Human (GRCh38)
Location 6:106159473-106159495 6:106159497-106159519
Sequence CCGAGTCAGGGCTGTGATTCTGA CTGCAGTGTGGGGAAGGTGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 9, 3: 78, 4: 543}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!