|
Left Crispr |
Right Crispr |
| Crispr ID |
1013021753 |
1013021762 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
6:106228254-106228276
|
6:106228300-106228322
|
| Sequence |
CCATCCACCACTGCTGTTTGCCG |
TCCATCCCTCTGGATCTAGCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 62, 1: 126, 2: 64, 3: 58, 4: 189} |
{0: 2, 1: 26, 2: 67, 3: 155, 4: 268} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|