ID: 1013283851_1013283854

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1013283851 1013283854
Species Human (GRCh38) Human (GRCh38)
Location 6:108663717-108663739 6:108663733-108663755
Sequence CCACGTCACGCAGCAGTGATGAG TGATGAGCTGGATGCGTGGACGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 4, 4: 75} {0: 2, 1: 0, 2: 2, 3: 11, 4: 272}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!