ID: 1013299958_1013299961

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1013299958 1013299961
Species Human (GRCh38) Human (GRCh38)
Location 6:108795569-108795591 6:108795604-108795626
Sequence CCATCTTCTGTCCAGGGAGAGGT TAGAAGCAAGAGGAGCCACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 11, 4: 220} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!