ID: 1013406669_1013406675

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1013406669 1013406675
Species Human (GRCh38) Human (GRCh38)
Location 6:109849778-109849800 6:109849822-109849844
Sequence CCATCTTCTACAGATAACTACTC GGCCAGTTACTGGGCTTTGGTGG
Strand - +
Off-target summary No data {0: 2, 1: 149, 2: 160, 3: 104, 4: 195}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!