ID: 1013472396_1013472405

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1013472396 1013472405
Species Human (GRCh38) Human (GRCh38)
Location 6:110476772-110476794 6:110476803-110476825
Sequence CCGCCTCGGCCTCCTTCCCGGCG TCCCGGCGCCCGCGGTCGCATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 32, 4: 414} {0: 1, 1: 0, 2: 0, 3: 4, 4: 59}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!