ID: 1013552009_1013552014

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1013552009 1013552014
Species Human (GRCh38) Human (GRCh38)
Location 6:111217100-111217122 6:111217143-111217165
Sequence CCTGACTGCTATTGGAGGGCACC ACAGCCTGCTGCTGCCCCCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 72} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!