ID: 1013974588_1013974590

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1013974588 1013974590
Species Human (GRCh38) Human (GRCh38)
Location 6:116062527-116062549 6:116062544-116062566
Sequence CCAATTTGTAAGTGGGGTTTTAG TTTTAGATTTTTGAATTGTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 180} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!